Review





Similar Products

99
New England Biolabs restriction enzyme bbsi
Restriction Enzyme Bbsi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bbsi/BbsI/pmc13095346-38-12-20
Average 99 stars, based on 1 article reviews
restriction enzyme bbsi - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

99
New England Biolabs bbsi hf
Bbsi Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bbsi/BbsI-HF/pm42129570-619-31-32
Average 99 stars, based on 1 article reviews
bbsi hf - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

99
New England Biolabs bbsi
Bbsi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bbsi/BbsI/pm42105764-217-16-17
Average 99 stars, based on 1 article reviews
bbsi - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

99
New England Biolabs restriction enzymes bbsi
Restriction Enzymes Bbsi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bbsi/BbsI/pm42107562-116-6-9
Average 99 stars, based on 1 article reviews
restriction enzymes bbsi - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

99
New England Biolabs bbsi overhangs
Bbsi Overhangs, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bbsi/BbsI/pm42103732-181-29-44
Average 99 stars, based on 1 article reviews
bbsi overhangs - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

99
New England Biolabs r3539s t4 dna ligase neb
R3539s T4 Dna Ligase Neb, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bbsi/BbsI-HF/pm42102812-772-151-155
Average 99 stars, based on 1 article reviews
r3539s t4 dna ligase neb - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

99
New England Biolabs plasmid with bbsi
Plasmid With Bbsi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bbsi/BbsI/pm42102812-811-6-9
Average 99 stars, based on 1 article reviews
plasmid with bbsi - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

99
New England Biolabs tggttacaggagggctcggca reverse translated epitope
Tggttacaggagggctcggca Reverse Translated Epitope, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bbsi/BbsI-HF/bio_rxiv__64898__2026__04__29__720676-150-13-18
Average 99 stars, based on 1 article reviews
tggttacaggagggctcggca reverse translated epitope - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

Image Search Results