|
New England Biolabs
restriction enzyme bbsi Restriction Enzyme Bbsi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bbsi/BbsI/pmc13095346-38-12-20 Average 99 stars, based on 1 article reviews
restriction enzyme bbsi - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
New England Biolabs
bbsi hf Bbsi Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bbsi/BbsI-HF/pm42129570-619-31-32 Average 99 stars, based on 1 article reviews
bbsi hf - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
New England Biolabs
bbsi Bbsi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bbsi/BbsI/pm42105764-217-16-17 Average 99 stars, based on 1 article reviews
bbsi - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
New England Biolabs
restriction enzymes bbsi Restriction Enzymes Bbsi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bbsi/BbsI/pm42107562-116-6-9 Average 99 stars, based on 1 article reviews
restriction enzymes bbsi - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
New England Biolabs
bbsi overhangs Bbsi Overhangs, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bbsi/BbsI/pm42103732-181-29-44 Average 99 stars, based on 1 article reviews
bbsi overhangs - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
New England Biolabs
r3539s t4 dna ligase neb R3539s T4 Dna Ligase Neb, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bbsi/BbsI-HF/pm42102812-772-151-155 Average 99 stars, based on 1 article reviews
r3539s t4 dna ligase neb - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
New England Biolabs
plasmid with bbsi Plasmid With Bbsi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bbsi/BbsI/pm42102812-811-6-9 Average 99 stars, based on 1 article reviews
plasmid with bbsi - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
New England Biolabs
tggttacaggagggctcggca reverse translated epitope Tggttacaggagggctcggca Reverse Translated Epitope, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bbsi/BbsI-HF/bio_rxiv__64898__2026__04__29__720676-150-13-18 Average 99 stars, based on 1 article reviews
tggttacaggagggctcggca reverse translated epitope - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |